For this project we had the task to research a disease that is causes by a protein. We talked about what protein synthesis is, information about the disease and how it affect us. Our final product was an video that talked about what our disease was and the process of protein synthesis. We chose to do Mad Cow Disease for our disease. This disease is also known as Bovine Spongiform Encephalopathy. This disease affects the nervous system and brain of cows. Humans get affected by this disease by eating the meat of the cows that contain this disease.
|
This disease is very uncommon and there have been very little cases. When this disease affects a human, it takes another name called Creutzfeldt Jakob disease. Our group chose to present this video through a video that we voiced over. Below is our video.
This project was fun to do, our group worked very well with talking about ideas and how we want to present it. We created a google document with all the information that we put on this video. Down below is the document we made.
Our Document
Protein to Disease
Disease: Mad cow: bovine spongiform encephalopathy
Transmissible, slowly progressive, degenerative, fatal disease that affects the nervous system of adult cattle. Once the cattle have the disease humans can get it by eating meat from mad cows. It affects the brain of cows and humans.
Protein: It changes the protein called a prion and makes it abnormal. It then destroys nervous system tissues, the brain, and the spinal cord. Scientists are not sure why the disease alters the protein.
Who gets it: You get this disease when you consume meat from the brain, nervous system, or spinal cord. It is most common in other countries due to the health regulation in the US. As of 2017, only 231 people have been affected by mad cow disease and only four deaths in the US that can from outside meat.
Symptoms: anxiety, depression, memory loss, insomnia, blurred vision or blindness
Treatments: Currently, there are no treatments against Mad Cow Disease, or any other prion diseases
Barriers for curing it: Scientists still don’t know fully how this disease works.
Brain from a sick cow with white holes caused by the prions.
Brain from a healthy cow
Current Research: UC San Diego and UC San Francisco have found that prion disease may enter the body through the eyes. Large amounts of altered prions were found in the eyes.
Lab in Switzerland developed a method to block prions. They fused two antibodies. One toxic and one nontoxic.
Protein Synthesis:
Human prion code: TAGCTGTGGCTCACACCTATA
AUCGACACCGAGUGUGGAUAU
Amino acid: Isoleucine, Aspartic Acid, Threonine, Glutamate, Cysteine, Glycine, Tyrosine
Cattle prion code: AGGAGAGTGGAGACCTTAAAG
UCCUCUCACCUCUGGAAUUUC
Amino acid: Serine, Serine, Histidine, Leucine, Tryptophan, Asparagine, Phenylalanine
Scientists are unsure how the prions change so diseased prions do not have information on them.
Difference between Creutzfeldt-Jakob and Mad cow:
Mad Cow disease originates in cow while Creutzfeldt originates in humans. Mad cow can then spread to humans while Jakob is never related to animals. Jakob is spread by contact with the nervous tissue of humans and mad cow is through contact with the nervous system of cows. Humans can get both of these diseases but one originates in cows.
3D Model:
The normal prion has mostly alpha helical sheets and some beta sheets while
in the altered prion there are more beta helical sheets and less alpha sheets due to changes in the folding process.
And here are our sites we used.
https://free3d.com/3d-model/prion-mad-cow-disease-7083.html
https://www.webmd.com/brain/mad-cow-disease-basics#1
https://www.fda.gov/animalveterinary/resourcesforyou/animalhealthliteracy/ucm136222.htm
https://www.news-medical.net/news/20181022/Researchers-produce-artificial-antibody-capable-of-blocking-prions-in-the-laboratory.aspx
https://www.news-medical.net/news/20181123/Eyes-may-be-portal-for-prions-to-enter-the-body-finds-study.aspx
https://study.com/academy/lesson/the-central-dogma-of-biology-definition-theory-quiz.html
https://proteopedia.org/wiki/index.php/Prion_protein
https://www.mayoclinic.org/diseases-conditions/creutzfeldt-jakob-disease/symptoms-causes/syc-20371226
https://www.healthychildren.org/English/health-issues/conditions/infections/Pages/Mad-Cow-Disease.aspx
https://serc.carleton.edu/microbelife/research_methods/genomics/translat.html
https://www.mayoclinic.org/diseases-conditions/creutzfeldt-jakob-disease/symptoms-causes/syc-20371226
https://www.ncbi.nlm.nih.gov/gene/5621
https://www.ncbi.nlm.nih.gov/gene/281427
https://molbiol-tools.ca/Amino_acid_abbreviations.htm
http://www.learner.org/interactives/dna/translatingmrna/
https://www.news-medical.net/health/How-Do-Prion-Diseases-Spread.aspx
https://www.sciencedaily.com/releases/2004/07/040729192250.htm
Summary:
Mad cow disease had no current treatments and information about prions is limited. Even though some of the symptoms are very serious and sometimes fatal, Mad cow is an uncommon disease and not that many people are affected by it. Scientists are continuing to learn more about prions and working towards a cure.
Disease: Mad cow: bovine spongiform encephalopathy
Transmissible, slowly progressive, degenerative, fatal disease that affects the nervous system of adult cattle. Once the cattle have the disease humans can get it by eating meat from mad cows. It affects the brain of cows and humans.
Protein: It changes the protein called a prion and makes it abnormal. It then destroys nervous system tissues, the brain, and the spinal cord. Scientists are not sure why the disease alters the protein.
Who gets it: You get this disease when you consume meat from the brain, nervous system, or spinal cord. It is most common in other countries due to the health regulation in the US. As of 2017, only 231 people have been affected by mad cow disease and only four deaths in the US that can from outside meat.
Symptoms: anxiety, depression, memory loss, insomnia, blurred vision or blindness
Treatments: Currently, there are no treatments against Mad Cow Disease, or any other prion diseases
Barriers for curing it: Scientists still don’t know fully how this disease works.
Brain from a sick cow with white holes caused by the prions.
Brain from a healthy cow
Current Research: UC San Diego and UC San Francisco have found that prion disease may enter the body through the eyes. Large amounts of altered prions were found in the eyes.
Lab in Switzerland developed a method to block prions. They fused two antibodies. One toxic and one nontoxic.
Protein Synthesis:
- Transcription is when the DNA sequence information is being converted to RNA, where a segment of DNA is copied into RNA. The double strand DNA molecule that is partially ‘unzipped’ has RNA polymerase copy the DNA’s nucleotides one by one turning it into an mRNA molecule. Unlike DNA, RNA has only a single strand, and is a more fragile and temporary molecule inside the cell. RNA is small and can easily exit the nucleus and go to the cytoplasm, where proteins are made. The mRNA leaves the nucleus to go to the cytoplasm and attach to ribosomes.
- Translation this is the process where the RNA molecule (nucleotide sequence) is now decoded into an amino acid sequence (protein). Ribosome matches the mRNA code in sets of three bases called codons. This creates tRNA with matching anticodon bases. The ribosome moves the mRNA along matching 3 base pairs each time and adding to a polypeptide chain. When the ribosome reaches a stop code it will release the mRNA and the new polypeptide chain. The chain forms its nature shape and goes into the cell to serve its function as a protein.
- mRNA binds with ribosome
- Ribosome matches the tRNA anticodon sequence with the mRNA codon sequences
- Each time a tRNA is copied it is added to the polypeptide chain
- The chain is released from the ribosome and it forms it shape and goes into the cell to perform its functions
- Protein folding:
- The protein will move and change until it has found its most stable state. It is guided by hydrophobic interactions and bonds between hydrogen molecules.
- Primary Structure: It starts with the amino acid chain and the location of the amino acid determine where it will fold.
- Secondary Structure: Hydrogen bonds quickly fold parts of the protein and they help to develop stability within the protein. Alpha helix and beta sheets: rough ER
- Tertiary Structure: Hydrophobic and philic reactions allow the protein to fold more towards the core that is hydrophobic.
- Quaternary Structure: Multiple polypeptide chains join together to form larger protein structures. Occurs in golgi body.
Human prion code: TAGCTGTGGCTCACACCTATA
AUCGACACCGAGUGUGGAUAU
Amino acid: Isoleucine, Aspartic Acid, Threonine, Glutamate, Cysteine, Glycine, Tyrosine
Cattle prion code: AGGAGAGTGGAGACCTTAAAG
UCCUCUCACCUCUGGAAUUUC
Amino acid: Serine, Serine, Histidine, Leucine, Tryptophan, Asparagine, Phenylalanine
Scientists are unsure how the prions change so diseased prions do not have information on them.
Difference between Creutzfeldt-Jakob and Mad cow:
Mad Cow disease originates in cow while Creutzfeldt originates in humans. Mad cow can then spread to humans while Jakob is never related to animals. Jakob is spread by contact with the nervous tissue of humans and mad cow is through contact with the nervous system of cows. Humans can get both of these diseases but one originates in cows.
3D Model:
The normal prion has mostly alpha helical sheets and some beta sheets while
in the altered prion there are more beta helical sheets and less alpha sheets due to changes in the folding process.
And here are our sites we used.
https://free3d.com/3d-model/prion-mad-cow-disease-7083.html
https://www.webmd.com/brain/mad-cow-disease-basics#1
https://www.fda.gov/animalveterinary/resourcesforyou/animalhealthliteracy/ucm136222.htm
https://www.news-medical.net/news/20181022/Researchers-produce-artificial-antibody-capable-of-blocking-prions-in-the-laboratory.aspx
https://www.news-medical.net/news/20181123/Eyes-may-be-portal-for-prions-to-enter-the-body-finds-study.aspx
https://study.com/academy/lesson/the-central-dogma-of-biology-definition-theory-quiz.html
https://proteopedia.org/wiki/index.php/Prion_protein
https://www.mayoclinic.org/diseases-conditions/creutzfeldt-jakob-disease/symptoms-causes/syc-20371226
https://www.healthychildren.org/English/health-issues/conditions/infections/Pages/Mad-Cow-Disease.aspx
https://serc.carleton.edu/microbelife/research_methods/genomics/translat.html
https://www.mayoclinic.org/diseases-conditions/creutzfeldt-jakob-disease/symptoms-causes/syc-20371226
https://www.ncbi.nlm.nih.gov/gene/5621
https://www.ncbi.nlm.nih.gov/gene/281427
https://molbiol-tools.ca/Amino_acid_abbreviations.htm
http://www.learner.org/interactives/dna/translatingmrna/
https://www.news-medical.net/health/How-Do-Prion-Diseases-Spread.aspx
https://www.sciencedaily.com/releases/2004/07/040729192250.htm
Summary:
Mad cow disease had no current treatments and information about prions is limited. Even though some of the symptoms are very serious and sometimes fatal, Mad cow is an uncommon disease and not that many people are affected by it. Scientists are continuing to learn more about prions and working towards a cure.
Prions are proteins that have been folded which can cause diseases in human and animal brains. Mad Cow's disease affects the protein which becomes a prion and doesn't it allow it to function correctly. It then destroys nervous system tissues, the brain, and the spinal cord.
Amino Acids are in all proteins. They make polypeptide chains which are single amino acids that make a chain and when are affected by a disease, get folded and become a prion.
Nucleotides give instructions and makes the proteins. Codons are 3 nucleotides that bring the mRNA which is used in the making of the protein and Anticodons are brought by the tRNA and are also a pair of 3 nucleotides.
RNA stands for ribonucleic acid. It is very important. RNA is the same thing as DNA except it is only half of the helix. this is refered to as the unzipped DNA. The mRNA, or messenger RNA, delivers the nucleotide sequence to the ribosomes. The tRNA, or transfer RNA, carries the amino acid sequence that the mRNA tells it to. This is known as the anticodon, along with the matching amino acids that make up some of the polypeptide chain.
A Polymerase is essentially a long chain of molecules that is made up of monomers, or small molecules.The polypeptide chain comes in two forms: The Helix or a sheet.
The nucleus is the main part of the cell. It is most important part of the cell.
Amino Acids are in all proteins. They make polypeptide chains which are single amino acids that make a chain and when are affected by a disease, get folded and become a prion.
Nucleotides give instructions and makes the proteins. Codons are 3 nucleotides that bring the mRNA which is used in the making of the protein and Anticodons are brought by the tRNA and are also a pair of 3 nucleotides.
RNA stands for ribonucleic acid. It is very important. RNA is the same thing as DNA except it is only half of the helix. this is refered to as the unzipped DNA. The mRNA, or messenger RNA, delivers the nucleotide sequence to the ribosomes. The tRNA, or transfer RNA, carries the amino acid sequence that the mRNA tells it to. This is known as the anticodon, along with the matching amino acids that make up some of the polypeptide chain.
A Polymerase is essentially a long chain of molecules that is made up of monomers, or small molecules.The polypeptide chain comes in two forms: The Helix or a sheet.
The nucleus is the main part of the cell. It is most important part of the cell.
This is a 3D model of the disease
Reflection
Overall this project was very fun. It was a very laid back project. Our group collaborated very well with what disease we wanted to do and how we wanted to present it. This project had challenging concepts to learn and understand. The research for the project went well, we all divided up the work to do. There wasn't a ton of information about cures because not a lot of people in the US or the world have gotten this disease. the video ended up being very long so that was kind of a downside. This project went 100% well there weren't any negatives. 2